Table 1

Genes analysed and real time RT-PCR conditions

Genes

GenBank1

Species2

Primers (5'→ 3')3

bp4

PCR conditions5


Ta

[nM]

r2

Slope


HSP27

BT021550

Bovine

F: TGGCGCGTGTCCCTGGA

80

60

300

0.990

-3.33

R: GTGATCTCCACCACGCC

300

HSP72

AY662497

Bovine

F: ACCCGCAGAACACGGTGTT

119

60

900

0.995

-3.33

R: AGGCTTGTCTCCGTCGTTGA

900

HSP73

NM_174345

Bovine

F: CAACCTGCTTGGCAAGTTTGA

108

60

900

0.990

-3.20

R: GAAACATTGAGGATGCCATTGG

900

HSP90

[30]

Ovine

F: AGTCTGGAGGATCCCCAGACA

78

60

300

0.994

-3.32

R: GGGTCATCCTCGTCAATACCA

300


1 GenBank accession numbers of the sequences used for primer design.

2 Species of origin of the sequences.

3 Primers (F: Forward and R: Reverse) used for the gene amplification.

4 Length of the amplicon in base pairs (bp).

5 Real-time RT-PCR conditions for gene expression analyses: annealing temperature (Ta), primer concentration ([nM]), correlation coefficient (r2) and slope of the standard curve.

Serrano et al. Veterinary Research 2011 42:13   doi:10.1186/1297-9716-42-13

Open Data